Two Genes, One Function?

The roles of Hoxb1a and Hoxb1b in the patterning of the zebrafish hindbrain

 

                                                                                        

 

A Student project by

Rebecca Loda

loda@unr.nevada.edu

 

Welcome to my website!  This site was put together to share information from the field of Developmental Biology.  You will find a discussion of recent research involving the developmental genes in the homeotic Hox gene family.  The majority of the information comes from a recent article Development.  The research reported in “Knockdown of duplicated zebrafish Hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention” by McClintock et al (Development 2002 May;129(10):2339-54 http://dev.biologists.org/cgi/content/full/129/10/2339) is summarized, with information from several supporting sources (see REFERENCES).

This project is for the course BIOL 480, Development Biology, Dr. Grant Mastick, Biology Department, University of Nevada, Reno.

http://med.unr.edu/homepage/gmastick/BIO480page/index.html

 

INTRODUCTION:

The Hox gene family belongs to a group of genes known as homeotic genes, which are highly conserved across species.  These gene groups are known to play a role in segmentation of various body structures.  Because of the conserved organization and functions of these genes between species, this is an active area of Developmental research.  It has been found that through the course of evolutionary history that the Hox gene family has undergone duplications, deletions, and function shufflings specific to different species.  While mammals have four Hox gene clusters in their genome, zebrafish have seven known clusters, and the possibility of an eighth that has yet to be identified has not been ruled out. 

 

Figure 1.  Diagram of the Hox gene clusters in zebrafish and mouse.  The specific genes considered in the experiments described here are colored in red.  Illustrated after Amores et al. Science 282(5394):1711-1715 1998, and Glover, J. C. Brain Research Bulletin 55(6): 683-693 2001. 

 

 

 

The Hox genes are expressed beginning early in development, and show a predictable pattern of expression.  The hindbrain gives rise to neurons and brancheal structures.  The Hox genes considered in the research of McClintock et al., Hoxb1a and Hoxb1b in zebrafish and Hoxa1 and Hoxb1 in mouse, are expressed in the hindbrain of both species. 

 

Figure 2.  Segmentation pattern of the zebrafish hindbrain at two stages of development.  Coloration is to aid identification of segments. 

Illustration after Schilling, Prince, and Ingham, Developmental Biology 231:201-216 2001. 

 

Zebrafish Embryo at 12 hrs.
 

Zebrafish Embryo at 24 hrs.
 

Dorsal view.
 

Lateral view
 

 

 

 

These specific genes are expressed in the r3 and r4 regions of the hindbrain in both species.  McClintock et al. wish to identify what role is played by each of these genes in the zebrafish, and how they have changed from those of similar genes present in mammals.  This will shed light not only on the properties of the genes, but also on the evolutionary processes involved. 

 

EXPERIMENTAL SYSTEM: Danio rerio

          The zebrafish is a relatively new experimental vertebrate system in developmental biology.  They have become popular research subjects for several reasons.  There are, however, some disadvantages to using zebrafish in developmental research. 

 

Advantages:                                                                                                              

Disadvantages:

 

Figure 3.  Zebrafish at different stages of development.  Illustrated after Beddington et al. Oxford, 2001.

 

4 cell stage
 

Adult
 

24 hrs.
 

 

The experiments discussed here took advantage of the available DNA sequence data and the ability to use morpholino-based knockdown mutants to study the role of Hoxb1a and Hoxb1b in the hindbrain patterning by eliminating expression of one or both of these genes. 

 

EXPERIMENTS & RESULTS:

            The research reported by McClintock et al. consisted of three main experiments.  Each gene was knocked down individually, and then a set of experiments was done in which the effects of eliminating both genes were observed.  In the case of individual knockdown, subsets of experiments were done to observe the effects on the development of the embryos, and also to see what, if any, gene products could rescue the mutants. 

            To do these experiments, antisense morpholinos were designed to bind to the bases surrounding the start of translation on the mRNA produced from each gene.  These morpholinos were injected into the embryo at the one- to four-cell stage.  The affects of these morpholinos were visualized with the help of in situ hybridization involving other gene products present in the structures affected by the Hoxb1a and Hoxb1b genes. 

 

Figure 4.  Summary of experimental techniques.  Morpholino was injected at the one- to four-cell stage, and the embryos were observed at various developmental stages.  Illustrated after McClintock et al. Development 129:2339-54 2002, and Beddington et al. Oxford, 2001. 

 

Compare expression to

wild-type embryos
 

Fix Embryo, Visualization
 

In Situ Hybridization

Anti-sense mRNA

For neuron-specific genes
 

Allow

Development
 

Zebrafish Embryo
 

Morpholino

 

MOb1a 5’ GGAACTGTCCATAGGCAATTAA 3’

OR

MOb1b 5’ AATTCATTGTTGACTGACCAAGCAA 3’
 

 

Experiment group 1: Knockdown of Hoxb1a

 

Hypothesis:  Hoxb1a is known to have stable expression in the r4 region of the hindbrain, and is predicted to have a role in the development of normal r4 identity. 

 

Experimental strategy:  McClintock et al. looked at two classes of neurons that have region-specific characteristics in embryos injected with the Hoxb1a morpholino and those that were untreated. 

·        Branchiomotor (BM) neurons undergo defined migration within the hindbrain, moving in a posterior direction as development continues, and have specific axon exit points. 

o       BM neuron character was assayed using individuals transgenic for a reporter construct that directs the expression of GFP in the BM neurons

·        The r4 region of the hindbrain is characterized by large reticulospinal (RS) interneurons known as Mauthner neurons. 

o       RS interneuron character was assayed by labeling the neurons with antibodies

 

Results:

·        Observation of the BM neurons

o       Hoxb1a is necessary for normal posterior migration of BM neurons

o       The BM neurons in the morpholino injected embryos took on characteristics of similar neurons in the more anterior r2 region of the hindbrain

o       Axon projection patterns were not affected by the knockdown of Hoxb1a

·        Observation of the RS interneurons

o       No observed affect of the knockdown of Hoxb1a on the RS interneurons

·        It was observed that the loss of the Hoxb1a protein down-regulated the transcription of the Hoxb1a gene

 

 

Experiment group 2: Knockdown of Hoxb1b

 

Hypothesis:  Because of observed patterns of expression, it is predicted that Hoxb1b is necessary for the proper patterning of the segments of the hindbrain.

 

Experimental strategy:  McClintock et al. used in situ hybridization to assay the character of the hindbrain segments in embryos injected with the Hoxb1b morpholino and those that were untreated.  The targets of the in situ hybridization were several genes with known patterns of expression within the hindbrain segments. 

 

Results:

·        The Hoxb1b morpholino caused a posterior shift in the boundary between the r3 and r4 regions, causing r3 to extend farther, and r4 to be reduced in extention.

·        There was no alteration in the BM or RS neurons except those expected due to the changes in the segments mentioned

 

 

Experiment group 3: Knockdown of Hoxb1a and Hoxb1b

 

Hypothesis:  Because of the observed results from the first two experiments, it was predicted that the results of knocking down both genes would be a combination of those in groups 1 and 2.

 

Experimental strategy:  Both morpholinos were injected simultaneously, and the embryos were assayed as described for the previous two groups of experiments.

 

Results:

·        The character of the RS interneurons was altered in the double-knockdown individuals, in addition to the alteration of the BM neurons also observed in the Hoxb1a knockdown individuals

·        Severe segment pattern alteration

 

 

Rescue experiments

 

            McClintock et al. conducted experiments to determine the capability of several different gene products to rescue the morpholino mutants.  They picked products that had similar functions to the genes knocked down by the morpholino, and the gene products were co-injected with the morpholino.  The results of these experiments are given in Table 1. 

 

Table 1.  Summary of the results of the rescue experiments.

 

Morpholino                                                                  Rescue agents and Results

 

                                                            Hoxb1a                        Hoxb1b                  Mouse Hoxb1

 

MOb1a                                                Rescued                     Not Rescued                  Rescued

 

MOb1b                                                Rescued                        Rescued                      Rescued

 

 

CONCLUSIONS:

·        Hoxb1a and Hoxb1b in zebrafish have somewhat overlapping functions, but they are not identical.  This is seen by:

o       Hoxb1a can rescue Hoxb1b mutants but the reverse is not true.

o       The presence of either functional gene is enough to maintain proper RS interneuron development

·        There is a re-arrangement of function, or “function shuffling” within the Hox clusters that has occurred between zebrafish and mammals

·        Zebrafish Hoxb1a has an autoregulatory mechanism, where the protein product allows further transcription

 

Table 2.  Summary of the functions of the two zebrafish Hox genes considered here.

 

Gene                    Mouse gene with similar function                    Functions

 

Hoxb1a                             Hoxb1                                            - Proper migration of r4-derived neurons

                                    - Mauthner neuron differentiation

 

Hoxb1b                             Hoxa1                                            - Proper segmentation of the hindbrain

                                                                                                - Mauthner neuron differntiation

 

 

 

Figure 5.  Diagram of the Hox gene clusters in zebrafish and mouse.  The genes which share similar functions (as shown by this study) are colored in the same color.  Illustrated after Amores et al. Science 282(5394):1711-1715 1998, and Glover, J. C. Brain Research Bulletin 55(6): 683-693 2001. 

 

 

 

SIGNIFICANCE:

The identification of the “shuffling” of functions between paralogous genes offers new insight into the evolution of vertebrates.  It may help in identifying the point of divergence of different species, as well as help in the understanding of evolutionary processes such as gene duplication and retention.  The fact that these two genes have been altered in such a way as to be complimentary to each other may also be of help in this area. 

            The shuffling of functions may help to identify genes with similar functions among species.  If there was a shift between zebrafish and mouse, it may be possible that another one happened between mouse and humans.  Knowing that such events occur may make it easier to support otherwise unusual results, or to initially identify the correct gene. 

 

FUTURE DIRECTIONS:

The observations of McClintock et al. offer many lines of future experiments.  It would be useful to know if such a shuffling event has happened with other members of the Hox gene family between different species.  One could also look into how the regulatory regions of a gene relate to those of paralogs, and possible predict were such an event may occur in the future.  It may even be possible to identify genes that are at various stages of these transitions, dividing up functions and altering expression.  There are many possibilities for new studies and lines of reasoning, expanding our knowledge of development, evolution, and gene expression. 

 

References:

Primary research article:

“Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention." McClintock, Kheirbek and Princ, 2002. Development May;129(10): 2339-54

http://dev.biologists.org/cgi/content/full/129/10/2339

This paper considers the role of two specific Hox genes, Hoxb1a and Hoxb1b, in the segmentation of the zebrafish hindbrain.  A morpholino-based knockdown approach was used, and revealed an important “function shuffling” event in the evolutionary history of the zebrafish. 

 

Review articles: 

“Correlated patterns of neuron differentiation and Hox gene expression in the hindbrain: a comparative analysis.” Glover, 2001. Brain Research Bulletin 55(6):683-693

http://sciserver.lanl.gov/cgi-bin/sciserv.pl?collection=journals&journal=03619230&issue=v55i0006

This review gives a comparative overview of the role of several specific Hox genes in the segmentation of the hindbrain in various species.  The main area of interest was the differentiation of neurons originating in the hindbrain.

 

“Hox genes and the segmental patterning of the vertebrate hindbrain.” Prince, 1998.  Amer. Zool. 38:634-646

http://web5.silverplatter.com/webspirs/start.ws?customer=c4184&databases=S(BX,BI)

Prince considers the cellular and molecular events involved in segmentation of the hindbrain, and compares expression patterns of Hox genes between species.  Also discussed is the zebrafish mutant valentino.

 

"Molecular mechanisms of segmental patterning in the vertibrate hindbrain and neural crest" Wilkinson, 1993. BioEssays Aug;15(8):499-505

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=7907865&dopt=Abstract

This review attempts to provide an understanding of some of the molecular mechanisms involved in regulating the expression of Hox genes, and thus controlling segmentation in the hindbrain.  Wilkinson considers the role of both the Krox-20 gene and retinoic acid in the regulation of Hox gene expression.

 

Related articles/books:

“Expression of zebrafish Hoxa1a in the neuronal cells of the midbrain and anterior hindbrain.”  Shih, Tsay, Lin, and Hwang, 2001.  Mechanisms of Development 101:279-281

http://sciserver.lanl.gov/cgi-bin/sciserv.pl?collection=journals&journal=09254773&issue=v101i1-2

Shih et al. looked at the expression pattern of the zebrafish Hoxa1a gene.  The pattern of expression was compared to the expression of the Hoxb1a and Hoxb1b genes.

 

“Plasticity in zebrafish hox expression in the hindbrain and cranial neural crest” Schilling, Prince, and Ingham 2001.  Dev Biol Mar 1;231(1):201-16

http://sciserver.lanl.gov/cgi-bin/sciserv.pl?collection=journals&journal=00121606&issue=v231i0001

By cell transplantation, Schilling et al. considered at what stage cells in hindbrain become committed to their anterior-posterior identity. They considered the expression of Hox genes in these cells to help answer this question.

 

Principles of Development second edition.  Beddington, Jessell, Lawrence, Meyerowtz, and Smith, 2001. Oxford, New York.

http://www.oup-usa.org/isbn/0199249393.html

This text book emphasizes the principles and key concepts of developmental biology, considering various vertebrate organisms, as well as plants, insects, and nematodes.

 

“Zebrafish Hox clusters and vertebrate genome evolution.” Amores, Force; et al 1998.  Science Nov;282(5394): 1711-1715.

http://www.sciencemag.org/cgi/content/full/282/5394/1711

Amores et al. consider the function of Hox genes in specifying cell fate in the anterior-posterior axis of the zebrafish.  They also suggest evolutionary events that have contributed to the current state of the Hox gene clusters in various species. 

 

 

This page was constructed by:  Rebecca Loda  loda@unr.nevada.edu  4/10/03